Sequence Alignment from Scratch with BWA

Table of Contents

The burrow wheeler algorithm is used to perform short read alignment, a cornerstone process in bioinformatics, especially next-generation sequencing. Short sequence alignment or mapping is one of the primary steps in re-sequencing projects where short reads from a fragmented genome are aligned back to a reference genome. We can use this aligned data to discover small or structural variations in clinical or population projects.

1. Intro

Try it out yourself at this notebook.

Living organisms have long strings of DNA in their cells and are made out of 4 bases A, T, C, G. The order that makes up the long stretches of DNA determines the characteristics of the cell. In the case of the human genome, the order of 3.25 billion of these bases decides the makeup of our cells. Over the last few decades, we have had technologies that can reveal this order of bases called sequencing. However, the majority of these sequencing technologies can only sequence around 100 bases which are not very long. However, the strength of these sequencing methods lies in their massive capacity to perform this sequencing operation millions of times in parallel. To get a more comprehensive view, we need to put these millions of small 100-base long sequences back together. It’s a wide puzzle with small and many pieces. We have sequenced genomes lots of organisms and now have picture for the puzzle that we can use as reference. However, not every individual and their genome is the same so when we are doing resequencing pieces come from a different picture. Having pieces from another picture makes solving the puzzle bit more challenging. We don’t know what is different in these pieces and we need to account for that unknown when putting the pieces together. Burrows-Wheeler Transform makes it possible to put these pieces to their place despite their variation. Our end goals is to identify these differences (variation) which makes that organism unique. There are few approaches but in this tutorial we are gonna use FM-index which is used by Burrows-Wheeler Aligner. There are lots of terminology here so lets explain while showing.

2. Implementation

2.1. What is Burrows Wheeler Transform

Burrows-wheeler algorithm relies on burrows wheeler transform. This transform is performed once on the reference sequence before the alignment.

  1. Burrows-Wheeler Transform(BWT) is performed by first getting the all the possible rotations (or circular shifts) of the sequence. Lets say we have example reference sequence string OMICSSBS. We can get the possible rotations with string splicing below.

We loop over the length of the string and for every loop we add slices of the string from start and end as the index increments we get the shifting effect.

from pprint import pprint

example_seq = "OMICSSBS$"
sequence_rotations = []
for index in range(len(example_seq)):
│   sequence_rotations.append(example_seq[index:] + example_seq[:index])
pprint(sequence_rotations)
['OMICSSBS$',
 'MICSSBS$O',
 'ICSSBS$OM',
 'CSSBS$OMI',
 'SSBS$OMIC',
 'SBS$OMICS',
 'BS$OMICSS',
 'S$OMICSSB',
 '$OMICSSBS']
  1. Then we sort rotations by a property we desire. In this case we are going to sort them alphabetically (or lexicographically if you’re fancy).
sorted_sequence_rotations = sorted(sequence_rotations)
pprint(sorted_sequence_rotations)
['$OMICSSBS',
 'BS$OMICSS',
 'CSSBS$OMI',
 'ICSSBS$OM',
 'MICSSBS$O',
 'OMICSSBS$',
 'S$OMICSSB',
 'SBS$OMICS',
 'SSBS$OMIC']
  1. We get the last column of this sorted rotation.
for sequence in sorted_sequence_rotations:
│   pprint(sequence[-1])
'S'
'S'
'I'
'M'
'O'
'$'
'B'
'S'
'C'

And that’s it. We done the BWT. To utilize this let’s move to next step creating the FM-index.

2.2. What is FM-index

To utilize BWT we need to keep a bit more information. This information is the initial order of the sequences before sorting. Here we use the itemgetter to sort the enumerated rotations by the sequences themselves.

from operator import itemgetter
initial_indices, sorted_sequence_rotations = zip(*sorted(enumerate(sequence_rotations), key=itemgetter(1)))

for index, sequence in zip(initial_indices, sorted_sequence_rotations):
│   print(f"Initial index: {index} of the: {sequence[-1]}")
Initial index: 8 of the: S
Initial index: 6 of the: S
Initial index: 3 of the: I
Initial index: 2 of the: M
Initial index: 1 of the: O
Initial index: 0 of the: $
Initial index: 7 of the: B
Initial index: 5 of the: S
Initial index: 4 of the: C

Suffix array is the sequences that are up character $ which is used by bowtie.

for index, sequence in zip(initial_indices, sorted_sequence_rotations):
│   print(f"Initial index: {index} of the sequence: {sequence.split('$')[0]}")
Initial index: 8 of the sequence:
Initial index: 6 of the sequence: BS
Initial index: 3 of the sequence: CSSBS
Initial index: 2 of the sequence: ICSSBS
Initial index: 1 of the sequence: MICSSBS
Initial index: 0 of the sequence: OMICSSBS
Initial index: 7 of the sequence: S
Initial index: 5 of the sequence: SBS
Initial index: 4 of the sequence: SSBS

We can keep the last column in a sequence.

last_column = ""
for sequence in sorted_sequence_rotations:
│   last_column += sequence[-1]
print(last_column)
SSIMO$BSC

This transformation is reversible and we can get our original sequence back by back tracking the characters in the sequence. To make this back tracking work we need a function that maps the character in last back to first. This is possible because index of an occurrence of a character in the first column will be the same in the last column. e.g. We have three S characters in our string OMICSSBS where the first occurrence of the string S in last column is the same S in the first column. We can keep track of the occurrences of S like below. You can watch the index beside the S characters and confirm they’re the same by the whole sequence besides them.

occurrence_of_s_in_first_column = 0
occurrence_of_s_in_last_column = 0
for index, sequence in zip(initial_indices, sorted_sequence_rotations):
│   if sequence[0] == 'S' and sequence[-1] == 'S':
│   │   print(f"{index=} sequence: {sequence} first: {sequence[0]} {occurrence_of_s_in_first_column} last: {sequence[-1]} {occurrence_of_s_in_last_column}")
│   │   occurrence_of_s_in_first_column += 1
│   │   occurrence_of_s_in_last_column += 1
│   elif sequence[0] == 'S':
│   │   print(f"{index=} sequence: {sequence} first: {sequence[0]} {occurrence_of_s_in_first_column} last: {sequence[-1]} 0")
│   │   occurrence_of_s_in_first_column += 1
│   elif sequence[-1] == 'S':
│   │   print(f"{index=} sequence: {sequence} first: {sequence[0]} 0 last: {sequence[-1]} {occurrence_of_s_in_last_column}")
│   │   occurrence_of_s_in_last_column += 1
│   else:
│   │   print(f"{index=} sequence: {sequence} first: {sequence[0]} 0 last: {sequence[-1]} 0")
index=8 sequence: $OMICSSBS first: $ 0 last: S 0
index=6 sequence: BS$OMICSS first: B 0 last: S 1
index=3 sequence: CSSBS$OMI first: C 0 last: I 0
index=2 sequence: ICSSBS$OM first: I 0 last: M 0
index=1 sequence: MICSSBS$O first: M 0 last: O 0
index=0 sequence: OMICSSBS$ first: O 0 last: $ 0
index=7 sequence: S$OMICSSB first: S 0 last: B 0
index=5 sequence: SBS$OMICS first: S 1 last: S 2
index=4 sequence: SSBS$OMIC first: S 2 last: C 0

Instead of counting them characters one by one like above lets count all the characters and keep it in a lookup index using the last column. The totals is how many times we see a character in total and tallymatrix is how many we saw up to a given point.

totals = {k: 0 for k in "".join(set(last_column))}
tallymatrix = {k: [] for k in "".join(set(last_column))}
for c in last_column:
│   totals[c] += 1
│   for k in tallymatrix.keys():
│   │   if k != c and tallymatrix[k]:
│   │   │   tallymatrix[k].append(tallymatrix[k][-1])
│   │   elif k == c:
│   │   │   tallymatrix[k].append(totals[c])
│   │   else:
│   │   │   tallymatrix[k].append(0)
print(totals)
print(tallymatrix)
{'O': 1, 'S': 3, 'M': 1, 'C': 1, 'B': 1, '$': 1, 'I': 1}
{'O': [0, 0, 0, 0, 1, 1, 1, 1, 1], 'S': [1, 2, 2, 2, 2, 2, 2, 3, 3], 'M': [0, 0, 0, 1, 1, 1, 1, 1, 1], 'C': [0, 0, 0, 0, 0, 0, 0, 0, 1], 'B': [0, 0, 0, 0, 0, 0, 1, 1, 1], '$': [0, 0, 0, 0, 0, 1, 1, 1, 1], 'I': [0, 0, 1, 1, 1, 1, 1, 1, 1]}

Using this we can rebuild a index of where we start and stop seeing the characters in the first column.

first = {}
totc = 0
for c, count in sorted(totals.items()):
│   first[c] = (totc, totc + count)
│   totc += count
print(first)
{'$': (0, 1), 'B': (1, 2), 'C': (2, 3), 'I': (3, 4), 'M': (4, 5), 'O': (5, 6), 'S': (6, 9)}

This simplified representation of the first column and BWT is the FM-index

2.3. Last to First Mapping

Using the we can map a given character with an index i back to first column. e.g S with second occurrence should map to row with initial index 4 witch is the 8th row.

print(first["S"][0] + tallymatrix["S"][2])
8

We can than reverse our transformation to build back our initial sequence. We remove one from the counts so we can use it as an index.

i = 0
t = "$"
while last_column[i] != "$":
│   c = last_column[i]
│   t = c + t
│   i = first[c][0] + tallymatrix[c][i] - 1
print(t)
OMICSSBS$

To get a better grasp of whats happening lets track the index jumps too.

i = 0
t = "$"
j = 0
print(f"loop\tloopindex\tindex\tinitial_ind\tfirst_column\tlast_column\tc\tt\n")
while last_column[i] != "$":
│   c = last_column[i]
│   t = c + t
│   i = first[c][0] + tallymatrix[c][i] - 1
│   j += 1
│   print(f"END{j:13} {i:8} {initial_indices[j]:8}{' '*14}{[seq[0] for seq in sorted_sequence_rotations][j]:12} {[seq[-1] for seq in sorted_sequence_rotations][j]:14} {c:3} {t}")
loop	loopindex	index	initial_ind	first_column	last_column	c	t

END          1          6          6                B               S           S       S$
END          2          1          3                C               I           B       BS$
END          3          7          2                I               M           S       SBS$
END          4          8          1                M               O           S       SSBS$
END          5          2          0                O               $           C       CSSBS$
END          6          3          7                S               B           I       ICSSBS$
END          7          4          5                S               S           M       MICSSBS$
END          8          5          4                S               C           O       OMICSSBS$

Here we are building up the initial sequence backwards. Observe below the “index”, “last​_column” and “c” columns. We initiate the index​=0 which points us to character S in the last column, this S in turn with its index​=6 points to preceding character B.

2.4. Building a class

Keeping track of the intermediately data and passing them through functions can become confusing to keep all this in one place lets put them in a class. Classes are a way of bundling data and functionality in python.

Our class aptly named BWA takes a reference sequence and creates the BWT and FM-index when initialized.

from operator import itemgetter


class BWA:
│   def __init__(self, ref):
│   │   """TODO: to be defined1."""
│   │   self.ref = ref + "$"
│   │
│   @property
│   def last(self):
│   │   '''
│   │   Get all the rotations of given sequence, sort them alphabetically and
│   │   return the last character from each rotation
│   │   '''
│   │   sa = [self.ref[i:] + self.ref[:i] for i in range(len(self.ref))]
│   │   return "".join(i[-1] for i in sorted(sa))
│   │
│   @property
│   def occ(self):
│   │   '''
│   │   Get the occurrences and total counts for each character in bwt
│   │   '''
│   │   totals = {}
│   │   tallymatrix = {k: [] for k in "".join(set(self.last))}
│   │   for c in self.last:
│   │   │   if c not in totals:
│   │   │   │   totals[c] = 0
│   │   │   totals[c] += 1
│   │   │   for k in tallymatrix.keys():
│   │   │   │   if k != c and tallymatrix[k]:
│   │   │   │   │   tallymatrix[k].append(tallymatrix[k][-1])
│   │   │   │   elif k == c:
│   │   │   │   │   tallymatrix[k].append(totals[c])
│   │   │   │   else:
│   │   │   │   │   tallymatrix[k].append(0)
│   │   return tallymatrix, totals
│   │
│   @property
│   def first(self):
│   │   '''
│   │   Get the lexicographical order of the characters
│   │   '''
│   │   first = {}
│   │   totc = 0
│   │   for c, count in sorted(self.occ[1].items()):
│   │   │   first[c] = totc
│   │   │   totc += count
│   │   return first
│   │
│   def lf(self, c, i):
│   │   """
│   │   The i-th occurrence of character ‘c’ in last is the same text character
│   │   as the i-th occurrence of ‘c’ in the first
│   │   """
│   │   return self.first[c] + self.occ[0][c][i] - 1
│   │
│   @property
│   def rebwt(self):
│   │   '''
│   │   rebuild the original sequence
│   │   '''
│   │   i = 0
│   │   t = "$"
│   │   while self.last[i] != "$":
│   │   │   c = self.last[i]
│   │   │   t = c + t
│   │   │   i = self.lf(c, i)
│   │   return t[:-1]

We can initialize our function with our reference and access the BWT and FM-index as its properties.

example_seq = "OMICSSBS"
bwa = BWA(example_seq)
print(f"{bwa.last=}")
print(f"{bwa.first=}")
print(f"{bwa.occ=}")
print(f"{bwa.rebwt=}")
bwa.last=('SSIMO$BSC', (8, 6, 3, 2, 1, 0, 7, 5, 4), ('$OMICSSBS', 'BS$OMICSS', 'CSSBS$OMI', 'ICSSBS$OM', 'MICSSBS$O', 'OMICSSBS$', 'S$OMICSSB', 'SBS$OMICS', 'SSBS$OMIC'))
bwa.first={'$': (0, 0), 'B': (1, 1), 'C': (2, 2), 'I': (3, 3), 'M': (4, 4), 'O': (5, 5), 'S': (6, 8)}
bwa.occ=({'O': [0, 0, 0, 0, 1, 1, 1, 1, 1], 'S': [1, 2, 2, 2, 2, 2, 2, 3, 3], 'M': [0, 0, 0, 1, 1, 1, 1, 1, 1], 'C': [0, 0, 0, 0, 0, 0, 0, 0, 1], 'B': [0, 0, 0, 0, 0, 0, 1, 1, 1], '$': [0, 0, 0, 0, 0, 1, 1, 1, 1], 'I': [0, 0, 1, 1, 1, 1, 1, 1, 1]}, {'S': 3, 'I': 1, 'M': 1, 'O': 1, '$': 1, 'B': 1, 'C': 1})
bwa.rebwt='OMICSSBS'

2.5. Mapping

2.5.1. Exact Matching

We want to align the small sequences back to references. If we have a read sequence with no variations. We can do a backward search to match a substring. We start by getting the minimum and maximum indices of the last character. Than we map these using our lf function in a loop.

low, high = self.last[0].find(read[-1]), self.last[0].rfind(read[-1])

i = len(read) - 1
while low <= high and i >= 0:
│   low = self.lf(read[i], low)
│   high = self.lf(read[i], high)
│   i -= 1
return low, high

Let’s add this to our class too.

from operator import itemgetter


class BWA:
│   .
│   .
│   .
│
│   def exact_match(self, read):
│   │   low, high = self.last[0].find(read[-1]), self.last[0].rfind(read[-1])
│   │
│   │   i = len(read) - 1
│   │   while low <= high and i >= 0:
│   │   │   low = self.lf(read[i], low)
│   │   │   high = self.lf(read[i], high)
│   │   │   i -= 1
│   │   return low, high
read = "OMI"
bwa = BWA(example_seq)
low, high = bwa.exact_match(read)
initial_ind = bwa.last[1][low]
print(low, high)
print(initial_ind)
print(example_seq[initial_ind:initial_ind + len(read)])
5 5
0
OMI

2.5.2. Inexact Matching

Most crucial part is of course matching the reads with variations. Backtracking algorithm described by (Li and Durbin 2009) accounts for insertions, deletions and mismatches.

fig3.jpeg

Inexact search calls the function calculate_diff initially which calculates the lower bound of differences for each character in the read string. Then we call the inexact_match which in turns calls itself recursively. This function has two stop conditions either we reach the end of the string or we run out of allowed differences.

class BWA:
│   .
│   .
│   .
│   def inexact_search(self, read, z):
│   │   self.calculate_diff(read)
│   │   return self.inexact_match(read, len(read) - 1, z, 1, len(self.last[0]) - 1)
│   │
│   │
│   def calculate_diff(self, read):
│   │   '''
│   │   Estimate the lower bound of allowed z for every character.
│   │   '''
│   │   low = 1
│   │   high = len(self.last[0]) - 1
│   │   diffs = []
│   │   z = 0
│   │   for c in read:
│   │   │   low = self.lf(c, low - 1) + 1
│   │   │   high = self.lf(c, high)
│   │   │   if low > high:
│   │   │   │   low = 1
│   │   │   │   high = len(self.last[0]) - 1
│   │   │   │   z +=  1
│   │   │   diffs.append(z)
│   │   self.diffs = diffs
│   │
│   │
│   def inexact_match(self, read, i, z, low, high):
│   │   '''
│   │   This function has two stop condition. Either we run out of the allowed
│   │   differences or we find a match.
│   │   '''
│   │   if z < self.diffs[i]:
│   │   │   return []
│   │   if i < 0:
│   │   │   return [[low,high]]
│   │   │
│   │   matches = []
│   │   matches.extend(self.inexact_match(read, i - 1, z - 1, low, high)) # Insertion
│   │   for c in set(self.last[0]):
│   │   │   low_ = self.lf(c, low - 1) + 1
│   │   │   high_ = self.lf(c, high)
│   │   │   if low <= high:
│   │   │   │   matches.extend(self.inexact_match(read, i, z - 1, low_, high_)) # Deletion
│   │   │   │   if c == read[i]:
│   │   │   │   │   matches.extend(self.inexact_match(read, i - 1, z, low_, high_)) # Match
│   │   │   │   else:
│   │   │   │   │   matches.extend(self.inexact_match(read, i - 1, z - 1, low_, high_)) # Mismatch
│   │   return matches

example_seq="OMICSSBS"
bwa = BWA(example_seq)
read = "OMC"

matches = bwa.inexact_search(read, 2)
print( matches)
for match in matches:
│   low, high = match
│   initial_ind = bwa.last[1][low]
│   print(example_seq[initial_ind:initial_ind + len(read)])
Hİ 6 [[5, 5], [5, 4], [4, 3], [5, 5], [5, 4], [5, 5]]
OMI
OMI
MIC
OMI
OMI
OMI

Visualizing the recursion

We can use some help to better visualize the recursion. Lets yank this snippet: https://github.com/arpitbbhayani/recviz/blob/master/src/recviz/rec.py and use a decorator.

class BWA:
│   .
│   .
│   .
│
│   @recviz
│   def inexact_match(self, read, i, z, low, high):
│   │   .
│   │   .
│   │   .

example_seq="OMICSSBS"
bwa = BWA(example_seq)
read = "OMC"

matches = bwa.inexact_search(read, 2)
print( matches)
for match in matches:
│   low, high = match
│   initial_ind = bwa.last[1][low]
│   print(example_seq[initial_ind:initial_ind + len(read)])
 -> inexact_match('OMC', 2, 2, 1, 8)
    -> inexact_match('OMC', 1, 1, 1, 8, 'ins')
       -> inexact_match('OMC', 0, 0, 1, 8, 'ins')
          -> inexact_match('OMC', -1, -1, 1, 8, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 3, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 3, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, 0, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 7, 8, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 7, 8, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 5, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 5, 5, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 2, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 2, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 1, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 3, 3, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 3, 3, 'missmatch')
          -> inexact_match('OMC', -1, -1, 3, 3, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 5, 4, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 0, 0, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 0, 0, 'missmatch')
          -> inexact_match('OMC', -1, -1, 0, 0, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 2, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 2, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 9, 6, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 9, 6, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 4, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 3, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 3, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 7, 8, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 7, 8, 'missmatch')
          -> inexact_match('OMC', -1, -1, 7, 8, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 8, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 8, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 5, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 5, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 2, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 2, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 4, 4, 'del')
       <- []
       -> inexact_match('OMC', 0, 1, 4, 4, 'match')
          -> inexact_match('OMC', -1, 0, 4, 4, 'ins')
          <- []
          -> inexact_match('OMC', 0, 0, 4, 3, 'del')
             -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 0, -1, 'del')
             -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 8, 7, 'del')
             -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 5, 4, 'del')
             -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 5, 5, 'del')
             -> inexact_match('OMC', -1, -1, 5, 5, 'ins')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 3, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 0, 0, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 0, 0, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 8, 7, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 5, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 6, 5, 'del')
             <- []
             -> inexact_match('OMC', -1, 0, 6, 5, 'match')
             <- []
             -> inexact_match('OMC', 0, -1, 2, 1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 1, 0, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
             <- []
          <- []
          -> inexact_match('OMC', -1, 1, 5, 5, 'match')
          <- [[5, 5, 'match']]
          -> inexact_match('OMC', 0, 0, 2, 1, 'del')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 1, 0, 'del')
             -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 1, 0, 'missmatch')
          <- []
       <- [[5, 5, 'match']]
       -> inexact_match('OMC', 1, 0, 5, 5, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 5, 5, 'missmatch')
          -> inexact_match('OMC', -1, -1, 5, 5, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, 0, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 5, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 5, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 2, 2, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 2, 2, 'missmatch')
          -> inexact_match('OMC', -1, -1, 2, 2, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 3, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 3, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 5, 4, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 1, 1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 1, 1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 1, 1, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 3, 2, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 3, 2, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 7, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 7, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 5, 4, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
    <- [[5, 5, 'match']]
    -> inexact_match('OMC', 2, 1, 3, 3, 'del')
       -> inexact_match('OMC', 1, 0, 3, 3, 'ins')
       <- []
       -> inexact_match('OMC', 2, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 0, -1, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 0, -1, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 8, 7, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 8, 7, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 4, 4, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 4, 4, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 1, 1, 2, 1, 'match')
          -> inexact_match('OMC', 0, 0, 2, 1, 'ins')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 2, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'missmatch')
       <- []
    <- []
    -> inexact_match('OMC', 1, 1, 3, 3, 'missmatch')
       -> inexact_match('OMC', 0, 0, 3, 3, 'ins')
          -> inexact_match('OMC', -1, -1, 3, 3, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 5, 4, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 4, 3, 'missmatch')
          -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 0, -1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 0, -1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 8, 7, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 8, 7, 'missmatch')
          -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 4, 4, 'del')
       <- []
       -> inexact_match('OMC', 0, 1, 4, 4, 'match')
          -> inexact_match('OMC', -1, 0, 4, 4, 'ins')
          <- []
          -> inexact_match('OMC', 0, 0, 4, 3, 'del')
             -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 0, -1, 'del')
             -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 8, 7, 'del')
             -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 5, 4, 'del')
             -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 5, 5, 'del')
             -> inexact_match('OMC', -1, -1, 5, 5, 'ins')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 3, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 0, 0, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 0, 0, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 8, 7, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 5, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 6, 5, 'del')
             <- []
             -> inexact_match('OMC', -1, 0, 6, 5, 'match')
             <- []
             -> inexact_match('OMC', 0, -1, 2, 1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 1, 0, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
             <- []
          <- []
          -> inexact_match('OMC', -1, 1, 5, 5, 'match')
          <- [[5, 5, 'match']]
          -> inexact_match('OMC', 0, 0, 2, 1, 'del')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 1, 0, 'del')
             -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 1, 0, 'missmatch')
          <- []
       <- [[5, 5, 'match']]
       -> inexact_match('OMC', 1, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 5, 4, 'missmatch')
          -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 2, 1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 1, 0, 'missmatch')
          -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
          <- []
       <- []
    <- [[5, 5, 'match']]
    -> inexact_match('OMC', 2, 1, 0, 0, 'del')
       -> inexact_match('OMC', 1, 0, 0, 0, 'ins')
       <- []
       -> inexact_match('OMC', 2, 0, 4, 2, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 4, 2, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 1, -1, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 1, -1, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 9, 6, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 9, 6, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 5, 3, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 5, 3, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 6, 4, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 6, 4, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 3, 1, 'del')
       <- []
       -> inexact_match('OMC', 1, 1, 3, 1, 'match')
          -> inexact_match('OMC', 0, 0, 3, 1, 'ins')
             -> inexact_match('OMC', -1, -1, 3, 1, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 2, 0, 2, 0, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 2, 0, 'missmatch')
       <- []
    <- []
    -> inexact_match('OMC', 1, 1, 0, 0, 'missmatch')
       -> inexact_match('OMC', 0, 0, 0, 0, 'ins')
          -> inexact_match('OMC', -1, -1, 0, 0, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 2, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 2, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 9, 6, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 9, 6, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 4, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 3, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 3, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 4, 2, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 4, 2, 'missmatch')
          -> inexact_match('OMC', -1, -1, 4, 2, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 1, -1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 1, -1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 1, -1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 9, 6, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 9, 6, 'missmatch')
          -> inexact_match('OMC', -1, -1, 9, 6, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 5, 3, 'del')
       <- []
       -> inexact_match('OMC', 0, 1, 5, 3, 'match')
          -> inexact_match('OMC', -1, 0, 5, 3, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 6, 4, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 6, 4, 'missmatch')
          -> inexact_match('OMC', -1, -1, 6, 4, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 3, 1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 3, 1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 3, 1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 2, 0, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 2, 0, 'missmatch')
          -> inexact_match('OMC', -1, -1, 2, 0, 'ins')
          <- []
       <- []
    <- []
    -> inexact_match('OMC', 2, 1, 7, 8, 'del')
       -> inexact_match('OMC', 1, 0, 7, 8, 'ins')
       <- []
       -> inexact_match('OMC', 2, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 8, 8, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 8, 8, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 6, 5, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 6, 5, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 2, 2, 'del')
       <- []
       -> inexact_match('OMC', 1, 1, 2, 2, 'match')
          -> inexact_match('OMC', 0, 0, 2, 2, 'ins')
             -> inexact_match('OMC', -1, -1, 2, 2, 'ins')
             <- []
             -> inexact_match('OMC', 0, -1, 3, 3, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 3, 3, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 0, -1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 8, 7, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 3, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 5, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, 0, 5, 4, 'match')
             <- []
             -> inexact_match('OMC', 0, -1, 2, 1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 1, 0, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 3, 3, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 3, 3, 'missmatch')
             -> inexact_match('OMC', -1, -1, 3, 3, 'ins')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 3, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 0, -1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 8, 7, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 4, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 5, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, 0, 5, 4, 'match')
             <- []
             -> inexact_match('OMC', 0, -1, 2, 1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 1, 0, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 0, -1, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 0, -1, 'missmatch')
             -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 8, 7, 'missmatch')
             -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', 0, 1, 4, 3, 'match')
             -> inexact_match('OMC', -1, 0, 4, 3, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 5, 4, 'missmatch')
             -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 2, 1, 'missmatch')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 1, 0, 'missmatch')
             -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 2, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 2, 1, 'missmatch')
       <- []
    <- []
    -> inexact_match('OMC', 1, 1, 7, 8, 'missmatch')
       -> inexact_match('OMC', 0, 0, 7, 8, 'ins')
          -> inexact_match('OMC', -1, -1, 7, 8, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 8, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 8, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 5, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 5, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 2, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 2, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 4, 3, 'missmatch')
          -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 1, 0, 'missmatch')
          -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 8, 8, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 8, 8, 'missmatch')
          -> inexact_match('OMC', -1, -1, 8, 8, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 9, 8, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 9, 8, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 5, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 5, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 2, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 2, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 0, 1, 5, 4, 'match')
          -> inexact_match('OMC', -1, 0, 5, 4, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 6, 5, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 6, 5, 'missmatch')
          -> inexact_match('OMC', -1, -1, 6, 5, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 2, 2, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 2, 2, 'missmatch')
          -> inexact_match('OMC', -1, -1, 2, 2, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 3, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 3, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 5, 4, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 2, 1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
          <- []
       <- []
    <- []
    -> inexact_match('OMC', 2, 1, 4, 4, 'del')
       -> inexact_match('OMC', 1, 0, 4, 4, 'ins')
       <- []
       -> inexact_match('OMC', 2, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 0, -1, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 0, -1, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 8, 7, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 8, 7, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 5, 5, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 5, 5, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 1, 1, 2, 1, 'match')
          -> inexact_match('OMC', 0, 0, 2, 1, 'ins')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 2, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'missmatch')
       <- []
    <- []
    -> inexact_match('OMC', 1, 1, 4, 4, 'missmatch')
       -> inexact_match('OMC', 0, 0, 4, 4, 'ins')
          -> inexact_match('OMC', -1, -1, 4, 4, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 5, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 5, 5, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 4, 3, 'missmatch')
          -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 0, -1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 0, -1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 8, 7, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 8, 7, 'missmatch')
          -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 0, 1, 5, 4, 'match')
          -> inexact_match('OMC', -1, 0, 5, 4, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 5, 5, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 5, 5, 'missmatch')
          -> inexact_match('OMC', -1, -1, 5, 5, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, 0, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 5, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 5, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 2, 1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 1, 0, 'missmatch')
          -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
          <- []
       <- []
    <- []
    -> inexact_match('OMC', 2, 1, 5, 5, 'del')
       -> inexact_match('OMC', 1, 0, 5, 5, 'ins')
       <- []
       -> inexact_match('OMC', 2, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 0, 0, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 0, 0, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 8, 7, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 8, 7, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 6, 5, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 6, 5, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 1, 1, 2, 1, 'match')
          -> inexact_match('OMC', 0, 0, 2, 1, 'ins')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 2, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'missmatch')
       <- []
    <- []
    -> inexact_match('OMC', 1, 1, 5, 5, 'missmatch')
       -> inexact_match('OMC', 0, 0, 5, 5, 'ins')
          -> inexact_match('OMC', -1, -1, 5, 5, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, 0, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 5, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 5, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 4, 3, 'missmatch')
          -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 0, 0, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 0, 0, 'missmatch')
          -> inexact_match('OMC', -1, -1, 0, 0, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 2, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 2, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 9, 6, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 9, 6, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 4, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 3, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 3, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 8, 7, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 8, 7, 'missmatch')
          -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 0, 1, 5, 4, 'match')
          -> inexact_match('OMC', -1, 0, 5, 4, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 6, 5, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 6, 5, 'missmatch')
          -> inexact_match('OMC', -1, -1, 6, 5, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 2, 1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 1, 0, 'missmatch')
          -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
          <- []
       <- []
    <- []
    -> inexact_match('OMC', 2, 1, 2, 2, 'del')
       -> inexact_match('OMC', 1, 0, 2, 2, 'ins')
       <- []
       -> inexact_match('OMC', 2, 0, 3, 3, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 3, 3, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 0, -1, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 0, -1, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 8, 7, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 8, 7, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 1, 1, 2, 1, 'match')
          -> inexact_match('OMC', 0, 0, 2, 1, 'ins')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 2, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'missmatch')
       <- []
    <- []
    -> inexact_match('OMC', 1, 2, 2, 2, 'match')
       -> inexact_match('OMC', 0, 1, 2, 2, 'ins')
          -> inexact_match('OMC', -1, 0, 2, 2, 'ins')
          <- []
          -> inexact_match('OMC', 0, 0, 3, 3, 'del')
             -> inexact_match('OMC', -1, -1, 3, 3, 'ins')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 3, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 0, -1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 8, 7, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 4, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 5, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, 0, 5, 4, 'match')
             <- []
             -> inexact_match('OMC', 0, -1, 2, 1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 1, 0, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 3, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 0, -1, 'del')
             -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 8, 7, 'del')
             -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 4, 3, 'del')
             -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 5, 4, 'del')
             -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 1, 5, 4, 'match')
          <- [[5, 4, 'match']]
          -> inexact_match('OMC', 0, 0, 2, 1, 'del')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 1, 0, 'del')
             -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 1, 0, 'missmatch')
          <- []
       <- [[5, 4, 'match']]
       -> inexact_match('OMC', 1, 1, 3, 3, 'del')
          -> inexact_match('OMC', 0, 0, 3, 3, 'ins')
             -> inexact_match('OMC', -1, -1, 3, 3, 'ins')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 3, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 0, -1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 8, 7, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 4, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 5, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, 0, 5, 4, 'match')
             <- []
             -> inexact_match('OMC', 0, -1, 2, 1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 1, 0, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 4, 3, 'missmatch')
             -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 0, -1, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 0, -1, 'missmatch')
             -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 8, 7, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 8, 7, 'missmatch')
             -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 4, 4, 'del')
          <- []
          -> inexact_match('OMC', 0, 1, 4, 4, 'match')
             -> inexact_match('OMC', -1, 0, 4, 4, 'ins')
             <- []
             -> inexact_match('OMC', 0, 0, 4, 3, 'del')
                -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
                <- []
             <- []
             -> inexact_match('OMC', -1, 0, 4, 3, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, 0, 0, -1, 'del')
                -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
                <- []
             <- []
             -> inexact_match('OMC', -1, 0, 0, -1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, 0, 8, 7, 'del')
                -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
                <- []
             <- []
             -> inexact_match('OMC', -1, 0, 8, 7, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, 0, 5, 4, 'del')
                -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
                <- []
             <- []
             -> inexact_match('OMC', -1, 0, 5, 4, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, 0, 5, 5, 'del')
                -> inexact_match('OMC', -1, -1, 5, 5, 'ins')
                <- []
                -> inexact_match('OMC', 0, -1, 4, 3, 'del')
                <- []
                -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
                <- []
                -> inexact_match('OMC', 0, -1, 0, 0, 'del')
                <- []
                -> inexact_match('OMC', -1, -1, 0, 0, 'missmatch')
                <- []
                -> inexact_match('OMC', 0, -1, 8, 7, 'del')
                <- []
                -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
                <- []
                -> inexact_match('OMC', 0, -1, 5, 4, 'del')
                <- []
                -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
                <- []
                -> inexact_match('OMC', 0, -1, 6, 5, 'del')
                <- []
                -> inexact_match('OMC', -1, 0, 6, 5, 'match')
                <- []
                -> inexact_match('OMC', 0, -1, 2, 1, 'del')
                <- []
                -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
                <- []
                -> inexact_match('OMC', 0, -1, 1, 0, 'del')
                <- []
                -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
                <- []
             <- []
             -> inexact_match('OMC', -1, 1, 5, 5, 'match')
             <- [[5, 5, 'match']]
             -> inexact_match('OMC', 0, 0, 2, 1, 'del')
                -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
                <- []
             <- []
             -> inexact_match('OMC', -1, 0, 2, 1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, 0, 1, 0, 'del')
                -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
                <- []
             <- []
             -> inexact_match('OMC', -1, 0, 1, 0, 'missmatch')
             <- []
          <- [[5, 5, 'match']]
          -> inexact_match('OMC', 1, 0, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 5, 4, 'missmatch')
             -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 2, 1, 'missmatch')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', 1, 0, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', 0, 0, 1, 0, 'missmatch')
             -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
             <- []
          <- []
       <- [[5, 5, 'match']]
       -> inexact_match('OMC', 0, 1, 3, 3, 'missmatch')
          -> inexact_match('OMC', -1, 0, 3, 3, 'ins')
          <- []
          -> inexact_match('OMC', 0, 0, 4, 3, 'del')
             -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 0, -1, 'del')
             -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 8, 7, 'del')
             -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 8, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 4, 4, 'del')
             -> inexact_match('OMC', -1, -1, 4, 4, 'ins')
             <- []
             -> inexact_match('OMC', 0, -1, 4, 3, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 0, -1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 8, 7, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 8, 7, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 5, 4, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 5, 5, 'del')
             <- []
             -> inexact_match('OMC', -1, 0, 5, 5, 'match')
             <- []
             -> inexact_match('OMC', 0, -1, 2, 1, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
             <- []
             -> inexact_match('OMC', 0, -1, 1, 0, 'del')
             <- []
             -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 4, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 5, 4, 'del')
             -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 1, 5, 4, 'match')
          <- [[5, 4, 'match']]
          -> inexact_match('OMC', 0, 0, 2, 1, 'del')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, 0, 1, 0, 'del')
             -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
             <- []
          <- []
          -> inexact_match('OMC', -1, 0, 1, 0, 'missmatch')
          <- []
       <- [[5, 4, 'match']]
       -> inexact_match('OMC', 1, 1, 0, -1, 'del')
          -> inexact_match('OMC', 0, 0, 0, -1, 'ins')
             -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 0, 1, 0, -1, 'missmatch')
          -> inexact_match('OMC', -1, 0, 0, -1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 1, 8, 7, 'del')
          -> inexact_match('OMC', 0, 0, 8, 7, 'ins')
             -> inexact_match('OMC', -1, -1, 8, 7, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 0, 1, 8, 7, 'missmatch')
          -> inexact_match('OMC', -1, 0, 8, 7, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 1, 4, 3, 'del')
          -> inexact_match('OMC', 0, 0, 4, 3, 'ins')
             -> inexact_match('OMC', -1, -1, 4, 3, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 0, 2, 4, 3, 'match')
          -> inexact_match('OMC', -1, 1, 4, 3, 'ins')
          <- [[4, 3, 'ins']]
       <- [[4, 3, 'ins']]
       -> inexact_match('OMC', 1, 1, 5, 4, 'del')
          -> inexact_match('OMC', 0, 0, 5, 4, 'ins')
             -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 0, 1, 5, 4, 'missmatch')
          -> inexact_match('OMC', -1, 0, 5, 4, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 1, 2, 1, 'del')
          -> inexact_match('OMC', 0, 0, 2, 1, 'ins')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 0, 1, 2, 1, 'missmatch')
          -> inexact_match('OMC', -1, 0, 2, 1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 1, 1, 0, 'del')
          -> inexact_match('OMC', 0, 0, 1, 0, 'ins')
             -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 0, 1, 1, 0, 'missmatch')
          -> inexact_match('OMC', -1, 0, 1, 0, 'ins')
          <- []
       <- []
    <- [[5, 4, 'match'], [5, 5, 'match'], [5, 4, 'match'], [4, 3, 'ins']]
    -> inexact_match('OMC', 2, 1, 1, 1, 'del')
       -> inexact_match('OMC', 1, 0, 1, 1, 'ins')
       <- []
       -> inexact_match('OMC', 2, 0, 3, 2, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 3, 2, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 0, -1, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 0, -1, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 7, 7, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 7, 7, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'missmatch')
       <- []
       -> inexact_match('OMC', 2, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 1, 1, 2, 1, 'match')
          -> inexact_match('OMC', 0, 0, 2, 1, 'ins')
             -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
             <- []
          <- []
       <- []
       -> inexact_match('OMC', 2, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'missmatch')
       <- []
    <- []
    -> inexact_match('OMC', 1, 1, 1, 1, 'missmatch')
       -> inexact_match('OMC', 0, 0, 1, 1, 'ins')
          -> inexact_match('OMC', -1, -1, 1, 1, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 3, 2, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 3, 2, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 0, -1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 0, -1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 7, 7, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 7, 7, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 5, 4, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 3, 2, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 3, 2, 'missmatch')
          -> inexact_match('OMC', -1, -1, 3, 2, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 0, -1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 0, -1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 0, -1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 7, 7, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 7, 7, 'missmatch')
          -> inexact_match('OMC', -1, -1, 7, 7, 'ins')
          <- []
          -> inexact_match('OMC', 0, -1, 4, 3, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 4, 3, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 1, 0, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 1, 0, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 8, 8, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 8, 8, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 5, 4, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 5, 4, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 6, 5, 'del')
          <- []
          -> inexact_match('OMC', -1, 0, 6, 5, 'match')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
          -> inexact_match('OMC', 0, -1, 2, 1, 'del')
          <- []
          -> inexact_match('OMC', -1, -1, 2, 1, 'missmatch')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 4, 3, 'del')
       <- []
       -> inexact_match('OMC', 0, 1, 4, 3, 'match')
          -> inexact_match('OMC', -1, 0, 4, 3, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 5, 4, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 5, 4, 'missmatch')
          -> inexact_match('OMC', -1, -1, 5, 4, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 2, 1, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 2, 1, 'missmatch')
          -> inexact_match('OMC', -1, -1, 2, 1, 'ins')
          <- []
       <- []
       -> inexact_match('OMC', 1, 0, 1, 0, 'del')
       <- []
       -> inexact_match('OMC', 0, 0, 1, 0, 'missmatch')
          -> inexact_match('OMC', -1, -1, 1, 0, 'ins')
          <- []
       <- []
    <- []
 <- [[5, 5, 'match'], [5, 5, 'match'], [5, 4, 'match'], [5, 5, 'match'], [5, 4, 'match'], [4, 3, 'ins']]
[[5, 5, 'match'], [5, 5, 'match'], [5, 4, 'match'], [5, 5, 'match'], [5, 4, 'match'], [4, 3, 'ins']]
OMI match
OMI match
OMI match
OMI match
OMI match
MIC ins

2.6. Putting it all together

from operator import itemgetter


class BWA:
│   def __init__(self, ref):
│   │   """todo: to be defined1."""
│   │   self.ref = ref + "$"
│   │
│   @property
│   def last(self):
│   │   sa = [self.ref[i:] + self.ref[:i] for i in range(len(self.ref))]
│   │   idx, sa = zip(*sorted(enumerate(sa), key=itemgetter(1)))
│   │   return "".join(i[-1] for i in sa), idx, sa
│   │
│   @property
│   def occ(self):
│   │   '''
│   │   get the occurrences and total counts for each character in bwt
│   │   '''
│   │   totals = {}
│   │   tallymatrix = {k: [] for k in "".join(set(self.last[0]))}
│   │   for c in self.last[0]:
│   │   │   if c not in totals:
│   │   │   │   totals[c] = 0
│   │   │   totals[c] += 1
│   │   │   for k in tallymatrix.keys():
│   │   │   │   if k != c and tallymatrix[k]:
│   │   │   │   │   tallymatrix[k].append(tallymatrix[k][-1])
│   │   │   │   elif k == c:
│   │   │   │   │   tallymatrix[k].append(totals[c])
│   │   │   │   else:
│   │   │   │   │   tallymatrix[k].append(0)
│   │   return tallymatrix, totals
│   │
│   @property
│   def first(self):
│   │   '''
│   │   because first column is alphabetically sorted
│   │   its enough to just to get start and end position for each character.
│   │   '''
│   │   first = {}
│   │   totc = 0
│   │   for c, count in sorted(self.occ[1].items()):
│   │   │   first[c] = (totc, totc + count - 1)
│   │   │   totc += count
│   │   return first
│   │
│   def lf(self, c, i):
│   │   """
│   │   the i-th occurrence of character ‘c’ in last
│   │   column is the same text character as the i-th
│   │   occurrence of ‘c’ in the first column
│   │   """
│   │   return self.first[c][0] + self.occ[0][c][i] - 1
│   │
│   @property
│   def rebwt(self):
│   │   i = 0
│   │   t = "$"
│   │   while self.last[0][i] != "$":
│   │   │   c = self.last[0][i]
│   │   │   t = c + t
│   │   │   i = self.lf(c, i)
│   │   return t[:-1]
│   │
│   def exact_match(self, read):
│   │   low, high = self.last[0].find(read[-1]), self.last[0].rfind(read[-1])
│   │
│   │   i = len(read) - 1
│   │   while low <= high and i >= 0:
│   │   │   low = self.lf(read[i], low - 1) + 1
│   │   │   high = self.lf(read[i], high)
│   │   │   i -= 1
│   │   return low, high
│   │
│   │
│   def inexact_search(self, read, z):
│   │   self.calculate_diff(read)
│   │   return self.inexact_match(read, len(read) - 1, z, 1, len(self.last[0]) - 1)
│   │
│   │
│   def calculate_diff(self, read):
│   │   '''
│   │   estimate the lower bound of allowed z for every character.
│   │   '''
│   │   low = 1
│   │   high = len(self.last[0]) - 1
│   │   diffs = []
│   │   z = 0
│   │   for c in read:
│   │   │   low = self.lf(c, low - 1) + 1
│   │   │   high = self.lf(c, high)
│   │   │   if low > high:
│   │   │   │   low = 1
│   │   │   │   high = len(self.last[0]) - 1
│   │   │   │   z +=  1
│   │   │   diffs.append(z)
│   │   self.diffs = diffs
│   │
│   │
│   def inexact_match(self, read, i, z, low, high):
│   │   '''
│   │   this function has two stop condition. either we run out of the allowed
│   │   differences or we find a match.
│   │   '''
│   │   if z < self.diffs[i]:
│   │   │   return []
│   │   if i < 0:
│   │   │   return [[low, high]]
│   │   │
│   │   matches = []
│   │   matches.extend(self.inexact_match(read, i - 1, z - 1, low, high)) # insertion
│   │   for c in set(self.last[0]):
│   │   │   low_ = self.lf(c, low - 1) + 1
│   │   │   high_ = self.lf(c, high)
│   │   │   if low <= high:
│   │   │   │   matches.extend(self.inexact_match(read, i, z - 1, low_, high_)) # deletion
│   │   │   │   if c == read[i]:
│   │   │   │   │   matches.extend(self.inexact_match(read, i - 1, z, low_, high_)) # match
│   │   │   │   else:
│   │   │   │   │   matches.extend(self.inexact_match(read, i - 1, z - 1, low_, high_)) # mismatch
│   │   return matches

2.7. Trying out with dummy data

2.7.1. Sequence generation

Lets generate our reference genome first. We are going to use the same approach as we did in motif finding post. We are going to create our reference sequence with length 1200 with same probability of .25 for all the bases. We add $ character at the end to denote the end of the string which will be useful when we do the burrows wheeler below.

import random
random.seed(0)
alphabet = ['A', 'C', 'G', 'T']
seq_weights = [.25, .25, .25, .25]
seq_length = 120

ref_seq = "".join(
│   random.choices(population=alphabet, weights=seq_weights, k=seq_length)
)
print(ref_seq)
TTCCGCTCCGTGCTGCTTTTCGTGCACGTTCTCTGAGCTGACTACTAGATTCACGTAGGGTGTGGCGCGCAAGGCATTTTTTGCGCTTTGTGCGTTTAGCGTAGAATCTAAGAGTGGAGG

2.7.2. Mutating the sequence

We want our reads to be different from our reference so, before sampling our samples we are going to create a mutated sequence first. Here with the mutated function we decide if mutation occurs with the given percentage and if it does type of the mutation. With the mutate_read function we either insert a single base, substitute a base or remove a base.

def mutated(mutation_rate):
│   r = random.randint(1,100)
│   if r <= mutation_rate:
│   │   r = random.randint(1,100)
│   │   if r <= 25:
│   │   │   return 'del'
│   │   elif 25 < r <= 50:
│   │   │   return 'ins'
│   │   else:
│   │   │   return 'sub'
│   else:
│   │   return False
│   │
│   │
def mutate(sequence, mutation_rate):
│   mutated_seq = ''
│   mutated_once = False
│   for base in sequence:
│   │   mutatition_type = mutated(mutation_rate)
│   │   match mutatition_type:
│   │   │   case 'del':
│   │   │   │   pass
│   │   │   case 'ins':
│   │   │   │   possible_mutations = "".join(['A', 'T', 'C', 'G'])
│   │   │   │   mutantion = random.choice(possible_mutations)
│   │   │   │   mutated_seq += base
│   │   │   │   mutated_seq += mutantion
│   │   │   case 'sub':
│   │   │   │   possible_mutations = "".join(['A', 'T', 'C', 'G'])
│   │   │   │   possible_mutations = possible_mutations.replace(base, '')
│   │   │   │   mutantion = random.choice(possible_mutations)
│   │   │   │   mutated_seq += mutantion
│   │   │   case _:
│   │   │   │   mutated_seq += base
│   return mutated_seq

After mutation with rate .5 we got our new mutated string some indels and substitutions.

mt_seq = mutate(ref_seq, 5)
print(f"{ref_seq=}")
print(f" {mt_seq=}")
ref_seq='TTCCGCTCCGTGCTGCTTTTCGTGCACGTTCTCTGAGCTGACTACTAGATTCACGTAGGGTGTGGCGCGCAAGGCATTTTTTGCGCTTTGTGCGTTTAGCGTAGAATCTAAGAGTGGAGG'
 mt_seq='TTCCGCTCCGTGCTGCTTTTCGTGCACGTTCTCTGAGCTGACTACTAATTCATGTAGGGTGTGGCGCGCAAGGCATTTTTTGCGCTTTGTGCGTTTGGCGTAGAACTAAGAGTGGAGG'

2.7.3. Getting the reads

Lets randomly sample 600 reads with length 6 from our mutated sequence.

number_of_reads = 600
read_length = 6
random_indices = [random.randrange(len(mt_seq) - read_length) for _ in range(number_of_reads)]
mt_reads = [mt_seq[i:i + read_length] for i in random_indices]
print(mt_reads[:20])
['AGAGTG', 'TCATGT', 'GCGTAG', 'GTAGGG', 'CTCCGT', 'TGAGCT', 'GCGCAA', 'GGCGCG', 'ATGTAG', 'TAGAAC', 'TAAGAG', 'TGACTA', 'TGGCGC', 'TAATTC', 'ATTTTT', 'GTTCTC', 'CGCGCA', 'TTTCGT', 'GCTGAC', 'TTTCGT']

We can now try to align our reads from the mutated_sequence back to the our reference. Since BWA returns many matches we are just gonna get the most common one using the snippet here.

# Code from: https://stackoverflow.com/a/1520716/7141527
# Get the most common match
import itertools
import operator

def most_common(L):
│ # get an iterable of (item, iterable) pairs
│ SL = sorted((x, i) for i, x in enumerate(L))
│ # print 'SL:', SL
│ groups = itertools.groupby(SL, key=operator.itemgetter(0))
│ # auxiliary function to get "quality" for an item
│ def _auxfun(g):
│   item, iterable = g
│   count = 0
│   min_index = len(L)
│   for _, where in iterable:
│   │ count += 1
│   │ min_index = min(min_index, where)
│   # print 'item %r, count %r, minind %r' % (item, count, min_index)
│   return count, -min_index
│ # pick the highest-count/earliest item
│ return max(groups, key=_auxfun)[0]

2.7.4. Performing the alignment

First lets initialize our BWA class with the ref_seq. Then we are going to align our mutated reads and keep track of the most common matches. Then we are going the get the initial_ind from bwa.last[1] using the low value.

bwa = BWA(ref_seq)
alignment_indices = []
for mt_read in mt_reads:
│   matches=bwa.inexact_search(mt_read, 2)
│   if matches:
│   │   # match = most_common(matches)
│   │   match = matches[0]
│   │   alignment_indices.append(bwa.last[1][match[0]])
│   else:
│   │   alignment_indices.append(0)
│   │
print(f"{   random_indices[:20]=}")
print(f"{alignment_indices[:20]=}")
   random_indices[20:]=[96, 12, 79, 102, 32, 68, 90, 103, 77, 18, 39, 12, 93, 9, 108, 87, 42, 60, 71, 12]
alignment_indices[20:]=[57, 12, 80, 39, 32, 69, 98, 109, 78, 18, 39, 12, 79, 9, 110, 88, 42, 61, 72, 12]

2.7.5. Outputing to SAM

Lets output our alignmets as Sequence Alignment/Map (SAM) format. SAM has header lines starting with `@´ and 11 fields denoting various alignment properties. We are going to fill in just the QNAME, POS, TLEN and SEQ fields.

Col Field Type Regexp/Range Brief description
1 QNAME String [!-?A-~]{1,254} Query template NAME
2 FLAG Int [0, \(2^{16}\) − 1] bitwise FLAG
3 RNAME String \*|[:rname:*=][:rname:]* Reference sequence NAME11
4 POS Int [0, \(2^{31}\) − 1] 1-based leftmost mapping POSition
5 MAPQ Int [0, \(2^{8}\) − 1] MAPping Quality
6 CIGAR String \*|([0-9]+[MIDNSHPX=])+ CIGAR string
7 RNEXT String \*|=|[:rname:*=][:rname:]* Reference name of the mate/next read
8 PNEXT Int [0, \(2^{31}\) − 1] Position of the mate/next read
9 TLEN Int [\(−2^{31} + 1, 2^{31} − 1\)] observed Template LENgth
10 SEQ String \*|[A-Za-z=.]+ segment SEQuence
11 QUAL String [!-~]+ ASCII of Phred-scaled base QUALity+33

For header we are going to print a version number, reference sequence name and length. For our alignments we are going to create a name for them and sort them and print their alignment index with their sequence. Ideally, reads that haven’t aligned should be flagged with 0x4. However we are just gonna skip them. Another thing we are skipping over is the CIGAR entries which says where are the indels and mismatches we are just gonna write everything is matched.

sam_contents = ""
sam_header = f"@HD\tVN:1.6\tSO:coordinate\n@SQ\tSN:REF\tLN:{len(ref_seq)}\n"
sam_contents += sam_header

mapped_reads = {i: read for i, read in sorted(zip(alignment_indices, mt_reads))}
for i, read in mapped_reads.items():
│   #                QNAME  FLAG RNAME POS MAPQ CIGAR RNEXT PNEXT TLEN SEQ     QUAL
│   if i == 0:
│   │   continue
│   else:
│   │   sam_contents += f"read{i}\t0\tREF\t{i+1}\t30\t6M\t*\t0\t{len(read)}\t{read}\t{'K'*len(read)}\n"
│   │
print(sam_contents)
@HD	VN:1.6	SO:coordinate
@SQ	SN:REF	LN:120
read1	0	REF	2	30	6M	*	0	6	TCCGCT	KKKKKK
read2	0	REF	3	30	6M	*	0	6	CCGCTC	KKKKKK
read3	0	REF	4	30	6M	*	0	6	CGCTCC	KKKKKK
read4	0	REF	5	30	6M	*	0	6	GCTCCG	KKKKKK
read5	0	REF	6	30	6M	*	0	6	CTCCGT	KKKKKK
read6	0	REF	7	30	6M	*	0	6	TCCGTG	KKKKKK
read7	0	REF	8	30	6M	*	0	6	CCGTGC	KKKKKK
read9	0	REF	10	30	6M	*	0	6	GTGCTG	KKKKKK
read10	0	REF	11	30	6M	*	0	6	TGCTTT	KKKKKK
read11	0	REF	12	30	6M	*	0	6	GCTGCT	KKKKKK
read12	0	REF	13	30	6M	*	0	6	CTGCTT	KKKKKK
read16	0	REF	17	30	6M	*	0	6	TTTTTT	KKKKKK
read17	0	REF	18	30	6M	*	0	6	TTTCGT	KKKKKK
read18	0	REF	19	30	6M	*	0	6	TTCGTG	KKKKKK
read19	0	REF	20	30	6M	*	0	6	TCGTGC	KKKKKK
read20	0	REF	21	30	6M	*	0	6	CGTGCT	KKKKKK
read21	0	REF	22	30	6M	*	0	6	GTGCAC	KKKKKK
read22	0	REF	23	30	6M	*	0	6	TGCACG	KKKKKK
read23	0	REF	24	30	6M	*	0	6	GCACGT	KKKKKK
read25	0	REF	26	30	6M	*	0	6	ACGTTC	KKKKKK
read26	0	REF	27	30	6M	*	0	6	CGTTCT	KKKKKK
read27	0	REF	28	30	6M	*	0	6	GTTCTC	KKKKKK
read28	0	REF	29	30	6M	*	0	6	TTCTCT	KKKKKK
read30	0	REF	31	30	6M	*	0	6	CTCTGA	KKKKKK
read31	0	REF	32	30	6M	*	0	6	TCTGAG	KKKKKK
read32	0	REF	33	30	6M	*	0	6	CTGAGC	KKKKKK
read33	0	REF	34	30	6M	*	0	6	TGAGCT	KKKKKK
read34	0	REF	35	30	6M	*	0	6	GAGCTG	KKKKKK
read35	0	REF	36	30	6M	*	0	6	AGCTGA	KKKKKK
read36	0	REF	37	30	6M	*	0	6	GCTGAC	KKKKKK
read37	0	REF	38	30	6M	*	0	6	CTGACT	KKKKKK
read38	0	REF	39	30	6M	*	0	6	TGACTA	KKKKKK
read39	0	REF	40	30	6M	*	0	6	GACTAC	KKKKKK
read40	0	REF	41	30	6M	*	0	6	ACTACT	KKKKKK
read41	0	REF	42	30	6M	*	0	6	CTACTA	KKKKKK
read42	0	REF	43	30	6M	*	0	6	TACTAA	KKKKKK
read44	0	REF	45	30	6M	*	0	6	CTAATT	KKKKKK
read48	0	REF	49	30	6M	*	0	6	ATTCAT	KKKKKK
read51	0	REF	52	30	6M	*	0	6	CATGTA	KKKKKK
read52	0	REF	53	30	6M	*	0	6	AATTCA	KKKKKK
read54	0	REF	55	30	6M	*	0	6	GTAGGG	KKKKKK
read55	0	REF	56	30	6M	*	0	6	TAGGGT	KKKKKK
read56	0	REF	57	30	6M	*	0	6	AGGGTG	KKKKKK
read57	0	REF	58	30	6M	*	0	6	GGGTGT	KKKKKK
read58	0	REF	59	30	6M	*	0	6	GGTGTG	KKKKKK
read59	0	REF	60	30	6M	*	0	6	GTGTGG	KKKKKK
read60	0	REF	61	30	6M	*	0	6	TGTGGC	KKKKKK
read61	0	REF	62	30	6M	*	0	6	GTGGCG	KKKKKK
read62	0	REF	63	30	6M	*	0	6	TGGCGT	KKKKKK
read63	0	REF	64	30	6M	*	0	6	GGCGCG	KKKKKK
read64	0	REF	65	30	6M	*	0	6	GCGCGC	KKKKKK
read65	0	REF	66	30	6M	*	0	6	CGCGCA	KKKKKK
read66	0	REF	67	30	6M	*	0	6	GCGCAA	KKKKKK
read67	0	REF	68	30	6M	*	0	6	CGCAAG	KKKKKK
read68	0	REF	69	30	6M	*	0	6	GCAAGG	KKKKKK
read69	0	REF	70	30	6M	*	0	6	CAAGGC	KKKKKK
read70	0	REF	71	30	6M	*	0	6	AAGGCA	KKKKKK
read71	0	REF	72	30	6M	*	0	6	AGGCAT	KKKKKK
read72	0	REF	73	30	6M	*	0	6	GGCATT	KKKKKK
read73	0	REF	74	30	6M	*	0	6	GCATTT	KKKKKK
read74	0	REF	75	30	6M	*	0	6	CATTTT	KKKKKK
read75	0	REF	76	30	6M	*	0	6	ATTTTT	KKKKKK
read77	0	REF	78	30	6M	*	0	6	TTTTTG	KKKKKK
read78	0	REF	79	30	6M	*	0	6	TTTTGC	KKKKKK
read79	0	REF	80	30	6M	*	0	6	TTTGGC	KKKKKK
read80	0	REF	81	30	6M	*	0	6	TTGCGC	KKKKKK
read81	0	REF	82	30	6M	*	0	6	TGCGCT	KKKKKK
read82	0	REF	83	30	6M	*	0	6	GCGCTT	KKKKKK
read83	0	REF	84	30	6M	*	0	6	CGCTTT	KKKKKK
read84	0	REF	85	30	6M	*	0	6	GCTTTT	KKKKKK
read85	0	REF	86	30	6M	*	0	6	CTTTTC	KKKKKK
read86	0	REF	87	30	6M	*	0	6	TTTGTG	KKKKKK
read87	0	REF	88	30	6M	*	0	6	TTGTGC	KKKKKK
read88	0	REF	89	30	6M	*	0	6	TGTGCG	KKKKKK
read89	0	REF	90	30	6M	*	0	6	GTGCGT	KKKKKK
read90	0	REF	91	30	6M	*	0	6	TGCGTT	KKKKKK
read92	0	REF	93	30	6M	*	0	6	CGTTTG	KKKKKK
read98	0	REF	99	30	6M	*	0	6	GCGTTT	KKKKKK
read99	0	REF	100	30	6M	*	0	6	CGTAGA	KKKKKK
read100	0	REF	101	30	6M	*	0	6	GTAGAA	KKKKKK
read101	0	REF	102	30	6M	*	0	6	TAGAAC	KKKKKK
read102	0	REF	103	30	6M	*	0	6	AGAACT	KKKKKK
read107	0	REF	108	30	6M	*	0	6	CTAAGA	KKKKKK
read108	0	REF	109	30	6M	*	0	6	TAAGAG	KKKKKK
read109	0	REF	110	30	6M	*	0	6	AAGAGT	KKKKKK
read110	0	REF	111	30	6M	*	0	6	AGAGTG	KKKKKK
read111	0	REF	112	30	6M	*	0	6	GAGTGG	KKKKKK
read112	0	REF	113	30	6M	*	0	6	AGTGGA	KKKKKK
read113	0	REF	114	30	6M	*	0	6	GTGGAG	KKKKKK

Lets write our alignments to a file as well as our reference sequence.

with open('myalignments.sam', 'w') as f:
│   f.write(sam_contents)
with open('ref.fasta', 'w') as f:
│   f.write('>REF\n')
│   f.write(ref_seq)

2.7.6. Visualizing our alignments with IGV

With SAM and FASTA files we can visualize our alignmets with IGV. We can convert our SAM to BAM and index both BAM and FASTA files with samtools.

samtools view ./myalignments.sam -bh > ./myalignments.bam
samtools index ./myalignments.bam

samtools faidx ./ref.fasta

igv.svg

3. References

Li, Heng, and Richard Durbin. 2009. “Fast and Accurate Short Read Alignment with Burrows-Wheeler Transform.” Bioinformatics (Oxford, England) 25 (14): 1754–60. https://doi.org/10.1093/bioinformatics/btp324.

Comments